View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20915_low_12 (Length: 228)
Name: NF20915_low_12
Description: NF20915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20915_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 36 - 210
Target Start/End: Complemental strand, 14880664 - 14880490
Alignment:
| Q |
36 |
catcaaccgccgtgaatcattgccaccttctttcccaccaatctcccctccctcaacagccacccattcccgccgcgactcgtatccgggtcccttccct |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14880664 |
catcaaccgccgtgaatcattgccaccttctttcccaccaatctcccctccctcaacagccactcattcccgccgcgactcgtatccgggtcccttccct |
14880565 |
T |
|
| Q |
136 |
tcattcccatcacctacctcctcacattctgaacaccctcccttacctctctaccatgcacgacgtgaatcatgt |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14880564 |
tcattcccatcacctacctcctctcattctgaacaccctcccttacctctctaccatgcacgacgtgaatcatgt |
14880490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University