View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20917_high_1 (Length: 616)
Name: NF20917_high_1
Description: NF20917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20917_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 7e-26; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 65 - 129
Target Start/End: Original strand, 36680082 - 36680146
Alignment:
| Q |
65 |
tgatgtcagtatgtagtagctctgaacacccggcattgagaacttcctttgcttgctctgtctgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36680082 |
tgatgtcagtatgtagtagctctgaacacccggcgttgagaacttcctttgcttgctctgtctgt |
36680146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 36686695 - 36686740
Alignment:
| Q |
22 |
aaatgaagaataacacgtgaccatttttaaacaacattccatgtga |
67 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36686695 |
aaatgaagaataacacgtgaccatttataaacaacattccatgtga |
36686740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 391 - 434
Target Start/End: Original strand, 36672178 - 36672221
Alignment:
| Q |
391 |
tatcttgatccttaattatagagttcaaatcttcacatggatag |
434 |
Q |
| |
|
||||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
36672178 |
tatcttgatacttagttatagagttcaaatcctcacatggatag |
36672221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University