View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20918_high_3 (Length: 248)
Name: NF20918_high_3
Description: NF20918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20918_high_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 6862058 - 6861811
Alignment:
| Q |
1 |
ctgtagaggtttacacttagcagagaaacattagggacctttcttttggttgctcattgaggccttttaggcccttacaagattaccctactgttgatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6862058 |
ctgtagaggtttacacttagcagagaaacattagggacctttcttttggttgctcattgaggccttttaggcccttacaagattaccctactgttgatag |
6861959 |
T |
 |
| Q |
101 |
tttgaagttcgaggtttgcttaaccaatttttcaagataaatcaccatatggattcaggtaataacattcttggccacaattttctttctctttatcctt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6861958 |
tttgaagttggaggtttgcttaaccaattcttcaagataaatcaccatatggattcaggtaataacattcttggccacaattttctttctctttatcctt |
6861859 |
T |
 |
| Q |
201 |
caagaaattcatggctatagactatgctgcattaaaatcagacatgaa |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6861858 |
caagaaattcatggctatagaatatgctgcattaaaatcagacatgaa |
6861811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University