View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_high_34 (Length: 349)
Name: NF20919_high_34
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 162 - 282
Target Start/End: Original strand, 24942002 - 24942119
Alignment:
| Q |
162 |
aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt |
261 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
24942002 |
aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt |
24942098 |
T |
|
| Q |
262 |
gttctattagttacatgttgc |
282 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24942099 |
gttctattagttacatgttgc |
24942119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University