View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_high_38 (Length: 322)
Name: NF20919_high_38
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 11 - 156
Target Start/End: Original strand, 51220545 - 51220690
Alignment:
| Q |
11 |
attattctcaacatcaaatcagttcaattgatgcaacatgcgatgatcacaaacaattacttgcatcagaagttattacatgcaagaacacattagatag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51220545 |
attattctcaacatcaaatcagttcaattgatggaacatgcgatgatcacaaacaattacttgcatcagaagttattacatgcaagaacacattagatag |
51220644 |
T |
 |
| Q |
111 |
gtgcaaattagtgtagcttagcttttcctttaccccgtatgattta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51220645 |
gtgcaaattagtgtagcttagcttttcctttaccccgtatgattta |
51220690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University