View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_high_66 (Length: 249)
Name: NF20919_high_66
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_high_66 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 32606495 - 32606255
Alignment:
| Q |
11 |
cataggggcataaatgtacttgcataaaaacatgtcgtgttctactttgtcacgtaaaggtctaaaacagtaag----attctctannnnnnnnccacta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32606495 |
cataggggcataaatgtacttgcataaaaacatgtcgtgttctactttgtcacgtaaaggtctaaaacagtaagtaagattctctattttttt-ccacta |
32606397 |
T |
 |
| Q |
107 |
aaataaacggataaatgaaagcaaaaagaaaatgtataggtacctgctgatgtttttgggttaaaactccaacgtcataaaccggggtaagatccggttt |
206 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606396 |
aaataaacggataaatgaaaggaaaaaaaaaa-gtatttgtacctgctgatgtttttgggttaaaactccaacgtcataaaccggggtaagatccggttt |
32606298 |
T |
 |
| Q |
207 |
aaacaacccataattctgctccgaaatagtaggtttaagattc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606297 |
aaacaacccataattctgctccgaaatagtaggtttaagattc |
32606255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University