View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_high_79 (Length: 223)
Name: NF20919_high_79
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_high_79 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 3293604 - 3293816
Alignment:
| Q |
14 |
cctgtgaaatttaacaccattttcattagaccacctacaaagcttttaacttgcaacctattttttaacttccaacctatttctaacagaacac----ac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
3293604 |
cctgtgaaatttaacaccattttcattagaccacctacaa-gcttttaacttgcaacctattttttaacttccaacctacttctaacagaacacacacac |
3293702 |
T |
 |
| Q |
110 |
acacaatcacttcctcaaaccttccaaccaaaaccactatatcaccttctttgagtgattctaaaaaccacttttctcttctccnnnnnnntggaaccaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3293703 |
acacaatcacttcctcaaaccttccaaccaaaaccactatatcaccttctttgagtgattctaaaaaccacttttctcttctccaaaaaaatggaaccaa |
3293802 |
T |
 |
| Q |
210 |
atgcgacaaaattc |
223 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
3293803 |
atgccacaaaattc |
3293816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University