View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20919_low_39 (Length: 322)

Name: NF20919_low_39
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20919_low_39
NF20919_low_39
[»] chr1 (1 HSPs)
chr1 (11-156)||(51220545-51220690)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 11 - 156
Target Start/End: Original strand, 51220545 - 51220690
Alignment:
11 attattctcaacatcaaatcagttcaattgatgcaacatgcgatgatcacaaacaattacttgcatcagaagttattacatgcaagaacacattagatag 110  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51220545 attattctcaacatcaaatcagttcaattgatggaacatgcgatgatcacaaacaattacttgcatcagaagttattacatgcaagaacacattagatag 51220644  T
111 gtgcaaattagtgtagcttagcttttcctttaccccgtatgattta 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
51220645 gtgcaaattagtgtagcttagcttttcctttaccccgtatgattta 51220690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University