View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_47 (Length: 285)
Name: NF20919_low_47
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 34429238 - 34429145
Alignment:
| Q |
8 |
agatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagattcttgttcgggaaga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429238 |
agatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagattcttgttcgggaaga |
34429145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 227 - 268
Target Start/End: Complemental strand, 34429019 - 34428978
Alignment:
| Q |
227 |
agttgaggaaatgtgagaaccgtcggaatctgaatcggaatc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429019 |
agttgaggaaatgtgagaaccgtcggaatctgaatcggaatc |
34428978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 12 - 100
Target Start/End: Original strand, 33738441 - 33738529
Alignment:
| Q |
12 |
gaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagattcttgttcgggaag |
100 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||| |||||||| | || |||||||| |||| |||||||||| ||||| |||||| |
|
|
| T |
33738441 |
gaagttgaaggagtgccagaggttcgttgtcggattttgaaagggaaggatgggatggatgggagagggaaagattgttgtttgggaag |
33738529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University