View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_51 (Length: 274)
Name: NF20919_low_51
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 44221903 - 44222145
Alignment:
| Q |
11 |
cacagatactaaacacaccgctgccaaagagaccagtgat-aatttaagaaaattgaactgataaattgatgtgttagtgtcgtgttggacaccaaactt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221903 |
cacagatactaaacacaccgctgccaaagaaac----gatcaatttaagaaaattgaactgataaattgatgtgttagtgtcgtgttggacaccaaactt |
44221998 |
T |
|
| Q |
110 |
accttcaatctaaagtaccagtgatacaggcattacaataacagaggnnnnnnncaactaaaatcatgacaaaacaacgcctaacctatcaatcaatgca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44221999 |
gccttcaatctaaagtaccagtgatacaggcattacaataacagaggaaaaaaacaactaaaatcatgacaaaacaacgcctaacctgtcaatcaatgca |
44222098 |
T |
|
| Q |
210 |
gaaaatcgagctctcttaatagtaagattcggatttgccgcagtaca |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44222099 |
gaaaatcgagctctcttaatagtaagattcggatttgccgcagtaca |
44222145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University