View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_54 (Length: 269)
Name: NF20919_low_54
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 32557663 - 32557421
Alignment:
| Q |
18 |
gatacattggaggctagtattaataacattaataacaatggaaattcctattttaacaacgacaatgttgagcttcctccgttgccaccggatattacta |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557663 |
gatacattggaggctggtattaataacattaataataatggaaattcctattttaacaacgacaatgttgagcttcctccgttgccaccggatattacta |
32557564 |
T |
|
| Q |
118 |
gctctgcctgttatagtccaggtgattcagtattcaacggaggcgatcatggttatttttattcatcatgggagcagaatgcatcagaagactgttataa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32557563 |
gctctgcctgttatagtccaggtgattcagtattcaacggaggcgatcatggttatttttattcatcatgggagcagaatgcatcagaagattgttataa |
32557464 |
T |
|
| Q |
218 |
taatcaaatgttgggaacaaatatgggaggtgcagagaataat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557463 |
taatcaaatgttgggaacaaatatgggaggtgcagagaataat |
32557421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University