View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_57 (Length: 255)
Name: NF20919_low_57
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_57 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] scaffold0442 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 10994699 - 10994629
Alignment:
| Q |
185 |
tatattcactgtcattttcatcatgcccatttttgaagtaaagcttgttgaaatgaagggaagggaacctt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10994699 |
tatattcactgtcattttcatcatgcccatttttgaagtaaagcttgttgaaatgaagggaagggaacctt |
10994629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 10994883 - 10994769
Alignment:
| Q |
6 |
tatttaatgtcattgcaagagnnnnnnncatttgcaaattattattttgtttctttttctactg-gctaacgaatttatatactttactgtgcttctttg |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
10994883 |
tatttaatgtcattgcaagagtttttttcatttgcaaattattattttgtttctttttctactgtgctaacgtatttatatacttgactgtgcttctttg |
10994784 |
T |
|
| Q |
105 |
tatccattcatattc |
119 |
Q |
| |
|
|||| ||| |||||| |
|
|
| T |
10994783 |
tatctattaatattc |
10994769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0442 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0442
Description:
Target: scaffold0442; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 108
Target Start/End: Original strand, 10442 - 10493
Alignment:
| Q |
58 |
ctttttctactg-gctaacgaatttatatactttactgtgcttctttgtatc |
108 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
10442 |
ctttttctactgcgctaacgtatttatatacttgactgtgcttctttgtatc |
10493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University