View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_69 (Length: 239)
Name: NF20919_low_69
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_69 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 21 - 239
Target Start/End: Complemental strand, 32524791 - 32524576
Alignment:
| Q |
21 |
agatagcttaggaattaaattgatggtttatcttttgatttagttagttgaaggccatgttgcgattgtgtttatccaacgatgaagtgttgtttaatta |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||| || ||||||||||||||||| |||||||||| |||||| || |
|
|
| T |
32524791 |
agatagctcaggaattaaattgatggtttatcttttgatttagttagctgaagggcatcttacgattgtgtttatccaaagatgaagtgtcgtttaacta |
32524692 |
T |
 |
| Q |
121 |
atagtaggtcatagaaaaattttaaacctatgataatgtttcgttcgaaaaacctcacgatactatttttaatgatctttgataatgcctcaacattgat |
220 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
32524691 |
atag---gtcatagagaaattttaaacctatgagaatgtttcgttcgaaaaacctcatgatactatttttaatgatctttgttaatgcctcgacattgat |
32524595 |
T |
 |
| Q |
221 |
tcattaggtgaaatagtcg |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32524594 |
tcattaggtgaaatagtcg |
32524576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University