View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_72 (Length: 237)
Name: NF20919_low_72
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 46455362 - 46455153
Alignment:
| Q |
12 |
ggtagagtcaaagatgtaaattcacccacatctattcacccttcttttccttatccctaatactcgggtctctatcaatttgtgttaattcacatcaatg |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455362 |
ggtagagtcaaatatgtaaattcacccacatctattcacccttcttttccttatccctaatactcgggtctctatcaatttgtgttaattcacatcaatg |
46455263 |
T |
 |
| Q |
112 |
aatgaactccaagtaattttttcctttcctgttgagtccctagcacttttttcttggcctttctttctccatcaaagagactagaaaaatgtttgccaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455262 |
aatgaactccaagtaattttttcctttcctgttgagtccctagcacttttttcttggcctttctttctccatcaaagagactagaaaaatgtttgccaca |
46455163 |
T |
 |
| Q |
212 |
cattacctct |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
46455162 |
cattacctct |
46455153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 3510982 - 3511023
Alignment:
| Q |
50 |
cccttcttttccttatccctaatactcgggtctctatcaatt |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3510982 |
cccttcttttccttatccctcttactcgggtctctatcaatt |
3511023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University