View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_76 (Length: 227)
Name: NF20919_low_76
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_76 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 46455971 - 46455746
Alignment:
| Q |
1 |
tttccgtatatgaatttttgttcagacttgctcatatataggtcttatgctacaagcagtaaaatggcatgttttggatttttgccaatgtaagtaatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455971 |
tttccgtatatgaatttttgttcagacttgctcatatataggtcttatgctacaagcagtaaa-tggcatgttttggatttttgccaatgtaagtaatgc |
46455873 |
T |
 |
| Q |
101 |
ggttttcttacatttggatttagaaagtgtataaaataaaagtggtaaacctcaggaaaatagaaaggaatgctatgttttgttattatgcttgggaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46455872 |
ggttttcttacatttggatttagaaagtgtataaaataaaagtggtaaacctcaggaaaatagaaaggaatactatgttttgttattatgcttgggaaat |
46455773 |
T |
 |
| Q |
201 |
ataatatcctctacatattttgttaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46455772 |
ataatatcctctacatattttgttaaa |
46455746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University