View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20919_low_77 (Length: 227)
Name: NF20919_low_77
Description: NF20919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20919_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 7 - 117
Target Start/End: Complemental strand, 44491524 - 44491406
Alignment:
| Q |
7 |
ctttatccactcttaaatgatgtagcttattaagtggcaatgc--------tttttctttttaagacaaaaatggcaatgcttaataacgaaatctattt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44491524 |
ctttatccactcttaaatgatgtagcttattaagtggcaatgccttttttttttttttttttaagacaaaagtggcaatgcttaataacgaaatctattt |
44491425 |
T |
|
| Q |
99 |
aattagagataatgttaga |
117 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44491424 |
aattagagataatgttaga |
44491406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 170 - 227
Target Start/End: Complemental strand, 44491352 - 44491295
Alignment:
| Q |
170 |
gaatcttctttcacaaaatttctcctcatcttcctcgcaagtaaattttctatctacc |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44491352 |
gaatcttctttcacaaaatttctccacatcttcctcgcaagtaaattttctatctacc |
44491295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University