View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2091_high_9 (Length: 238)
Name: NF2091_high_9
Description: NF2091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2091_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 226
Target Start/End: Complemental strand, 49302046 - 49301835
Alignment:
| Q |
15 |
atatctgaacttccacattcccttctatattctagtgtgataccagataattggtgactctctagaatttggtctggaatggtctgtaaaataatcaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302046 |
atatctgaacttccacattcccttctatattctagtgtgataccagataattggtgactctctagaatttggtctggaatggtctgtaaaataatcaata |
49301947 |
T |
 |
| Q |
115 |
atnnnnnnnntgaaagttaactatttgattatattctaataatggtataaatattgaagaatgataatgagtatattaatattgttttgaatttacctct |
214 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301946 |
ataaaaaaaatgaaagttaactatttgattatattctaataatggtataaatattgaagaatgataatgagtatattaatattgttttgaatttacctct |
49301847 |
T |
 |
| Q |
215 |
agcatccacctt |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49301846 |
agcatccacctt |
49301835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University