View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2091_low_1 (Length: 392)
Name: NF2091_low_1
Description: NF2091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2091_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 9 - 376
Target Start/End: Complemental strand, 38392975 - 38392608
Alignment:
| Q |
9 |
agcataggaacgaaactgcaaatcagcgaccgagacggataagcagattagagacacaagtgaataaaaaacgaagtctgagacataaatccagaaaaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38392975 |
agcataggaacgaaactgcaaatcagcgaccgagacggataagcagattagagacacaagtgaataaaaaacgaagtctgagacataaatccagaaaaag |
38392876 |
T |
 |
| Q |
109 |
caaattagagagagacaaaagatagagagcaaataatgacagcacgcggatgaggtgaaatatgaatcggaagccactatcaatattatttggttcattt |
208 |
Q |
| |
|
||||||| ||||||||||||||||| ||| |||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38392875 |
aaaattagtgagagacaaaagatagaatgcagataatgacagcacgcgcatgagctggaatatgaatcggaagccactatcaatattatttggttcattt |
38392776 |
T |
 |
| Q |
209 |
actaaatgacaagaaaataagtctagaactcaacattgaaggtctcgattcatcattaggatcactatattctgtggcaaatatcaatagtagcatgcag |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38392775 |
actaaatgacaagaaaataagtctagaactcaacattgaaggtttcgattcatcattaggatcactatattctgtggcaaatatcaatagtagcatgcag |
38392676 |
T |
 |
| Q |
309 |
caacataacatataagccaaccaagtgattgaagtttccacttgcattgacacaacaagtttagtttc |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38392675 |
caacataacatataagccaaccaagtgattgaagtttccacttgcattgacacaacaagtttaatttc |
38392608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University