View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2091_low_10 (Length: 239)
Name: NF2091_low_10
Description: NF2091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2091_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 22 - 214
Target Start/End: Original strand, 3354208 - 3354406
Alignment:
| Q |
22 |
ctgccatcatactccccgcaccacacggcttgttaatcagggctggatgacttgactttgggttagt------atgatgagaaattatcgcacatatctg |
115 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3354208 |
ctgccagcatactccccacaccacacggcttgttaatcagggctggatgacttgactttgggttagtaatagtatgatgagaaattatcgcacatatctg |
3354307 |
T |
|
| Q |
116 |
ttttaaatgactacatattacatgcgacaaaatttatagaagaagcaaaaatttcatttgcaagcaagaagttgatgtcaggtatgatccattttaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354308 |
ttttaaatgactacatattacatgcgacaaaatttatagaagaagcacaaattccatttgcaagcaagaagttgatgtcaggtatgatccattttaaag |
3354406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University