View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2091_low_2 (Length: 383)
Name: NF2091_low_2
Description: NF2091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2091_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 44805302 - 44804938
Alignment:
| Q |
18 |
ttactatgataatgaattatagtttctacagtgttgtaagagaatatatgtctgacatggtggttttgtccttataggatgttcggtccactgatgatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44805302 |
ttactatgataatgaattatagtttctacagtgttgtaagagaatatatgtctgacatggtggttttgtc-ttataggatgttcggtccactgatgatga |
44805204 |
T |
 |
| Q |
118 |
tttgattgaagtcatgtaacaagttgcagttctaaattttgtcattctcaaactttctatgtgtggagtttgcttgatctttttaggagtacagatgaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44805203 |
tttgattgaagtcatgtaacaagttgcagttctaaattttgtcattctcaaactttctatgtgtggagtttgcttgatctttttaggagtacagatgaaa |
44805104 |
T |
 |
| Q |
218 |
attagatttcttcttgtgtggtctatttaatagctgttaatgaagaccaagctgtattgatgttatggtttgtttgttatggtttatactctatattttg |
317 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44805103 |
attagatttcttcttgtgtggtccatttaatagctgttaatgaagaccaagctgtattgatgttatggtttgtttgttatggtttatactctatattttg |
44805004 |
T |
 |
| Q |
318 |
gttttattatattgtggaaactgcaatttgagataaatctgaatcttttgcaaattattatttctt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44805003 |
gttttattatattgtggaaactgcaatttgagataaatctgaatcttttgcaaattattatttctt |
44804938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University