View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2091_low_8 (Length: 244)
Name: NF2091_low_8
Description: NF2091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2091_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 8289830 - 8290047
Alignment:
| Q |
11 |
cacagagaactctcgcaggagggatagtaagagagtgtgcagaaaagtataatgatgcagcaaagttattcaactcaaaactctcaaagcagcttgattc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8289830 |
cacagagaactctcgcaggagggatagtaagagagtgtgcagaaaagtataatgatgcagcaaagttattcaactcaaaactctcaaagcagcttgattc |
8289929 |
T |
|
| Q |
111 |
tctaagtcagaactcacccaatagccggatagtttacattgatgtttacactcctctacttgatatcattgtcaactaccaaaaatatggtaattcctat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8289930 |
tctaagtcagaactcacccaatagccggatagtttacattgatgtttacactcctctacttgatatcattgtcaactaccaaaaatatggtaattcctat |
8290029 |
T |
|
| Q |
211 |
tttatcttaacttaatta |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8290030 |
tttatcttaacttaatta |
8290047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 8254270 - 8254344
Alignment:
| Q |
132 |
tagccggatagtttacattgatgtttacactcctctacttgatatcattgtcaactaccaaaaatatggtaattc |
206 |
Q |
| |
|
|||| |||| ||||| || |||||||||| ||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8254270 |
tagcaggattgtttatatggatgtttacaaccctatacttgatatcattgtaaactaccaaaaatatggtaattc |
8254344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 132 - 213
Target Start/End: Original strand, 8244698 - 8244779
Alignment:
| Q |
132 |
tagccggatagtttacattgatgtttacactcctctacttgatatcattgtcaactaccaaaaatatggtaattcctatttt |
213 |
Q |
| |
|
|||| |||| |||||||| |||||||||| |||||||| ||||| ||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
8244698 |
tagcaggatcgtttacatggatgtttacagccctctactcgatattattgtaaacaaccaaaaatatggtaattccaatttt |
8244779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 206
Target Start/End: Original strand, 31242638 - 31242677
Alignment:
| Q |
167 |
tacttgatatcattgtcaactaccaaaaatatggtaattc |
206 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
31242638 |
tacttgatatcattgtaaactacaaaaaatatggtaattc |
31242677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University