View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20920_high_26 (Length: 242)
Name: NF20920_high_26
Description: NF20920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20920_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 8342584 - 8342370
Alignment:
| Q |
11 |
cagagaaatgctaatgtgcacgacataggtgtcatacaaatctcacgaacgactcataaatggaacgtttccaaaaggcctagtttaaccatgttgtctt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
8342584 |
cagagaaatgctaatgtgcacgacataggtgtcatacaaatctcacgaacgactcataaatggaacgtttccaaatggcctagcttaaccatgttgtctt |
8342485 |
T |
 |
| Q |
111 |
tttaatagaaacgcagtggatactgttgttgcctccacctccaacggtggtggatgtgccgtctcctgtcgttttggaggca--caactccgaggccaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8342484 |
tttaatagaaacgcagtggatactgttgttgcctccacctccaatggtggtggatgtgccgtctcctgtcgttttggaggcatgccactccgaggccaat |
8342385 |
T |
 |
| Q |
209 |
catattagacacacc |
223 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
8342384 |
catatcagacacacc |
8342370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 224
Target Start/End: Original strand, 3228110 - 3228181
Alignment:
| Q |
155 |
cggtggtggatgtgccgtctcctgtcgttttggaggca--caactccgaggccaatcatattagacacacct |
224 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| | ||||||||||||||||||| ||| |||||| |
|
|
| T |
3228110 |
cggtggtggatgtgccgactcctgtcattttggaggcatgccactccgaggccaatcatatcagaaacacct |
3228181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University