View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20920_low_15 (Length: 339)
Name: NF20920_low_15
Description: NF20920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20920_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 143 - 330
Target Start/End: Original strand, 473796 - 473977
Alignment:
| Q |
143 |
cgtgcaatcgtgtttggagagcataagaactttagtttacttcaacaaaaaataataataataaagcctaggattgcatatataaataaggtttacc--a |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| | |
|
|
| T |
473796 |
cgtgcaatcgtgtttggagagcataagaactttagtttacttcaacaaaaaataataataaaaaagcctaggattgtatatataaataaggtttaccata |
473895 |
T |
|
| Q |
241 |
tctctttatattcacccnnnnnnnnnnnnnnnnnctttgagcaacgtgttttggaaagcaaagatgggatgtttagacatggagtattat |
330 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
473896 |
tctctttatattcaccc--------aaaaaaaaactttgagcaacgtgttttggaaagcaaagatgggatgtttagacatggagtattat |
473977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 290 - 326
Target Start/End: Original strand, 479411 - 479447
Alignment:
| Q |
290 |
tttggaaagcaaagatgggatgtttagacatggagta |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
479411 |
tttggaaagcaaagatgggatgtttagacatggagta |
479447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University