View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20920_low_19 (Length: 296)
Name: NF20920_low_19
Description: NF20920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20920_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 30 - 280
Target Start/End: Complemental strand, 108764 - 108514
Alignment:
| Q |
30 |
gtgaaagcaactctcttttttgtcagaactcatagccataaaactgagactggaattcgtccaccgttaggtcaaacttaaactttgccaaaagactcgg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108764 |
gtgaaagcaactctcttttttgtcagaactcatagccataaaactgagactggaattcgtccaccgttaggtcaaacttaaactttgccaaaagactcgg |
108665 |
T |
 |
| Q |
130 |
gatatgtaaatcttcgtttgcattagatggatcgtcaaaaacaagtatggaaaaagagatatatctcctcacatcttcttgttctcatttattaggctaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108664 |
gatatgtaaatcttcgtttgcattagatggatcgtcaaaaacaagtatggaaaaagagatatatctcctcacatcttcttgttctcatttattaggctaa |
108565 |
T |
 |
| Q |
230 |
tttttgggacaatttgtacactgtgtctctcttgtatacttatttgattac |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108564 |
tttttgggacaatttgtacactgtgtctctcttgtatacttatttgattac |
108514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University