View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20920_low_3 (Length: 595)
Name: NF20920_low_3
Description: NF20920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20920_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 482; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 482; E-Value: 0
Query Start/End: Original strand, 11 - 581
Target Start/End: Original strand, 34698839 - 34699392
Alignment:
| Q |
11 |
cataggggcgtccgagtgatttgttttggtcaaggattaacatttgtgtctcatgttctaactcatgtccgttggttccggtccaatgagttgtccacca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698839 |
cataggggcgtccgagtgatttgttttggtcaaggattaacatttgtgtctcatgttctaactcatgtccgttggttccggtccaatgagttgtccacca |
34698938 |
T |
 |
| Q |
111 |
aaccttaaaccggaatatactcatgaaccggattcctttgagtttgccaagtggaaccacgtggtggcttttgggttcggtggtgttgaaaccaacgaag |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698939 |
aaccttaaaacggaatatactcatgaaccggattcctttgagtttgccaagtggaaccacgtggtggcttttgggttcggtggtgttgaaaccaacgaag |
34699038 |
T |
 |
| Q |
211 |
caaccatgttgcaacgtggtattgtagttggtgtttttgttggatttggaattatggagaaaaggggaaggggtggtggttgttatgttgggtgggactt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34699039 |
caaccatgttgcaacgtggtattgtagttg------------gatttggaattatggagaaaaggggaaggggtggtggttgttatgttgggtgggactt |
34699126 |
T |
 |
| Q |
311 |
gagtgagaaaagggtgaccatttgcaagaaaacatgagtcgtttaaggtgatggataagggtgggttagttatatcgacgaggcctattacatctatggg |
410 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34699127 |
gagtgagaaaagggtggccatttgcaagaaaacatgagtcatttaaggtgatggataagggtgggttagttatttcgacgaggcctattacatctatggg |
34699226 |
T |
 |
| Q |
411 |
tgtagcggttttggttatgctcggtggtgccatggtgattgatgagaaacagagcttggttactactagctagtttaacttgatagctaacttggctcta |
510 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34699227 |
tgtagctgttttggttatgctcggtggtgccatggtgattgatgagagactgagcttggttactactagctagtttaacttgatagctaacttggctcta |
34699326 |
T |
 |
| Q |
511 |
tggttgaaaattggtggccagagtgtgggtttatatagagaaattaaaaaagaaagcctacatagttattg |
581 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34699327 |
tggttgaaaattggtggccagagtgtgggtttatatagag-----aaaaaagaaagcctacatagttattg |
34699392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University