View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20920_low_35 (Length: 209)
Name: NF20920_low_35
Description: NF20920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20920_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 50 - 182
Target Start/End: Complemental strand, 1951349 - 1951217
Alignment:
| Q |
50 |
tcaattaaaagtaaaatgtaaaaacaataaattatctaatacactataattgtttgaaattgaaacgaatctaactaaatttatgtaaaactacttaatt |
149 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951349 |
tcaattaaaagtgaaatgtaaaaacaataaattatctaatacactataattgtttgaaattgaaacgaatctaactaaatttatgtaaaactacttaatt |
1951250 |
T |
|
| Q |
150 |
taatgaaatctatcgaaatttcaatataatata |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1951249 |
taatgaaatctatcgaaatttcaatataatata |
1951217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University