View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20920_low_8 (Length: 414)
Name: NF20920_low_8
Description: NF20920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20920_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 112
Target Start/End: Complemental strand, 1521986 - 1521884
Alignment:
| Q |
10 |
caatgatatttacatatgcatatccattttgtgtactatatctaagataaacgtttgattttatatggtggtttacaatctacttgaggaaacctgaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1521986 |
caatgatatttacatatgcatatccattttgtgtaccatatctaagataaacgtttgattttatatggtggtttacaatctacttgaggaaacctgaatt |
1521887 |
T |
|
| Q |
110 |
taa |
112 |
Q |
| |
|
||| |
|
|
| T |
1521886 |
taa |
1521884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University