View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20921_low_5 (Length: 297)
Name: NF20921_low_5
Description: NF20921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20921_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 43393912 - 43394113
Alignment:
| Q |
19 |
gatgaatcggcaatgccaccgtcgattccattcacgaccaacgagagagcttcgtaacaacaaatttttcgccgtcatcttagtttgagtggataaaggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
43393912 |
gatgaatcggcaatgccaccgtcgattccatttacgaccaacgagagagcttcgtaacaacaaatttttcggcgtcatcttagtttgggtggataaaggc |
43394011 |
T |
|
| Q |
119 |
tccataccgttgtagttcatttgcagcaagttccgacagtagtaatagaaaatataac--acccatttgcaattccatcatattattacttgggtgatgg |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43394012 |
tccataccgttgcagttcatttgcagcaagttccaacagtagtaatagaaaatataacaaacccatttgcaattccatcatattattacttgggtgatgg |
43394111 |
T |
|
| Q |
217 |
ct |
218 |
Q |
| |
|
|| |
|
|
| T |
43394112 |
ct |
43394113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 78 - 173
Target Start/End: Complemental strand, 17547403 - 17547306
Alignment:
| Q |
78 |
acaaatttttcgccgtcatcttagtttgagtggataaaggctccataccgttgtagttcatttgcagcaagttccgacagtagta--atagaaaatat |
173 |
Q |
| |
|
|||||||| ||| | ||||||| |||| |||||||||||||||||||||| |||||||| ||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
17547403 |
acaaatttctcggcttcatcttggtttcagtggataaaggctccataccgccctagttcatctgcggcaggttccagcagtagtaggatagaaaatat |
17547306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University