View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20922_low_5 (Length: 214)
Name: NF20922_low_5
Description: NF20922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20922_low_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 39212369 - 39212156
Alignment:
| Q |
1 |
cctccgtaacaactcgctctctggacctattccagatctttctccacttacaaacctcaaatcactcttcctcgaccggaataatttctccggttcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39212369 |
cctccgtaacaactcgctctctggacctattccagatctttctccacttacaaacctcaaatcactcttcctcgaccggaataatttctccggttcattc |
39212270 |
T |
|
| Q |
101 |
cctccttccattctcttcctccatagactcatcactctttcactctctcataacaacctcaccggttcacttccggttcagttgactctcctcgaccgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39212269 |
cctccttccattctcttcctccatagactcatcactctttcactctctcataacaacctcactggttcacttccggttcagttaactctcctcgaccgtc |
39212170 |
T |
|
| Q |
201 |
ttattattctccgc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39212169 |
ttattattctccgc |
39212156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University