View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20923_low_4 (Length: 253)
Name: NF20923_low_4
Description: NF20923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20923_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 64 - 236
Target Start/End: Original strand, 6271002 - 6271174
Alignment:
| Q |
64 |
tttccatttttgatgatgacaacaagtttgtaacagcaatggccaaaaattttgtgcaaccctcttcagatagctaaattgttagttattggattaatct |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6271002 |
tttccatttttgatgatgacaacaagtttgtaacagcaatggccaaaaattttgtgcaaccctcttcagatagctaaattgttagttattggattgatct |
6271101 |
T |
 |
| Q |
164 |
aaaagttaaatgaattaatccaacttctggtaatttagctggagagggtttcttgctagtacttgcagtaaaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6271102 |
aaaagttaaatgaattaatccaacttctggtaatttagctggagagggttgcttgctagtacttgcagtaaaa |
6271174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 6270829 - 6270760
Alignment:
| Q |
1 |
ttttcccagatccaccaatcccagaaattccaacaagacaaaaatctttccttccaacaaccatttccat |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6270829 |
ttttcccagatccaccaatcccagaaattccaacaagacaaaaatctttccttccaacaaccatttccat |
6270760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University