View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20924_high_14 (Length: 238)

Name: NF20924_high_14
Description: NF20924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20924_high_14
NF20924_high_14
[»] chr6 (1 HSPs)
chr6 (168-222)||(32865799-32865853)


Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 168 - 222
Target Start/End: Complemental strand, 32865853 - 32865799
Alignment:
168 gaaaaatcacatgtttcatgtttgttcgatgagacaatcattgtacaatgattat 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
32865853 gaaaaatcacatgtttcatgtttgttcgatgagacaatcattgtactatgattat 32865799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University