View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20924_low_22 (Length: 234)
Name: NF20924_low_22
Description: NF20924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20924_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 216
Target Start/End: Original strand, 9476643 - 9476847
Alignment:
| Q |
9 |
ggtagattattcttgggaataattctaaagggataatctcagtatattcctaagtgtaaaatgatacttacacgactattcaatatattcttgtgtttct |
108 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
9476643 |
ggtagcttattcttgggaataattctaa-gggataatctcagtatattcctaagtgtaaaatgatacttacacgactattcaatat--tcttgcgtttct |
9476739 |
T |
 |
| Q |
109 |
ttttcttattttggtaaacaatactactattgtatttataaataatgcatgactattatacacgactattattcttatagtgtcgatagtcaaattttat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||| |||||||||| | | |||||||||||||||||| |
|
|
| T |
9476740 |
ttttcttattttggtaaacaatactactattgtatttttaaataatgtacgactattatacacgacaattattcttaaaatatcgatagtcaaattttat |
9476839 |
T |
 |
| Q |
209 |
tgtgaagt |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
9476840 |
tgtgaagt |
9476847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University