View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20925_low_13 (Length: 239)
Name: NF20925_low_13
Description: NF20925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20925_low_13 |
 |  |
|
| [»] scaffold0059 (1 HSPs) |
 |  |  |
|
| [»] scaffold0029 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 1048788 - 1049005
Alignment:
| Q |
1 |
tttatcttatgtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaaccgctagtataaatatagatccaccaaacgaactcccttcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048788 |
tttatcttatgtttggatgatttttattctcaaagccgaaccaaaccaaaccgcgaaccgctggtataaatatagatccaccaaacgaactcccttcaac |
1048887 |
T |
 |
| Q |
101 |
ttgaaccgcatatttttcatcaaannnnnnnnnnnnnnnnnnnnttgaacttcatattttgccttttgaactgttagtgatcattgtaatttatttaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048888 |
ttgaaccgcatatttttcatcaaa----agagggagaaaaaaaattgaacttcatattttgccttttgaactgttagtgatcattgtaatttatttaaat |
1048983 |
T |
 |
| Q |
201 |
gggtatcaaaatggaaggtact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1048984 |
gggtatcaaaatggaaggtact |
1049005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 2226970 - 2227017
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
2226970 |
gtttggatgttttttatgctcaaaaccgaaccaaaccactccgcgaac |
2227017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 15068457 - 15068410
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||| |||||||||| |
|
|
| T |
15068457 |
gtttggatgattattatgcttaaaaccgaaccaaaccgcaccgcgaac |
15068410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 23780821 - 23780774
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||| |||||||||| |
|
|
| T |
23780821 |
gtttggatgacttttatgcttaaaaccgaaccaaaccgcaccgcgaac |
23780774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 23867774 - 23867727
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||| |||||||||| |
|
|
| T |
23867774 |
gtttggatgacttttatgcttaaaaccgaaccaaaccgcaccgcgaac |
23867727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 30265877 - 30265924
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||| |||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
30265877 |
gtttagatgatttttatgctcaaaaccaaaccaaaccgcaccgcgaac |
30265924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 36103699 - 36103745
Alignment:
| Q |
12 |
tttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
36103699 |
tttggatgtattttatgctcaaaaccgaaccaaaccgcaccgcgaac |
36103745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 7760101 - 7760054
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7760101 |
gtttggatgatttttatgctcaaaatcgaaccaaaccacaccgcgaac |
7760054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 13852305 - 13852265
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacac |
51 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
13852305 |
gtttggatgacttttatgctcaaaaccgaaccaaaccacac |
13852265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 10069190 - 10069143
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
10069190 |
gtttagatgacttttatgctcaaaaccgaaccaaaccgcaccgcgaac |
10069143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 18673276 - 18673323
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
18673276 |
gtttggatgacttttatgctcaaaaccgaaccaaatcgcaccgcgaac |
18673323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 45898146 - 45898193
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
45898146 |
gtttggatgacttttatgcacaaaaccgaaccaaaccgcaccgcgaac |
45898193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 54
Target Start/End: Complemental strand, 47903244 - 47903201
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgc |
54 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||||| |
|
|
| T |
47903244 |
gtttggatgatttttatgcttaaaaccgaaccaaaccgcaccgc |
47903201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 10661150 - 10661103
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
10661150 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccgcgaac |
10661103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 14549220 - 14549173
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
14549220 |
gtttggatgacttttatgctcaaaaccgaatcaaaccacaccgcgaac |
14549173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 33068262 - 33068215
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
33068262 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccacgaac |
33068215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 35040296 - 35040343
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
35040296 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccgcgaac |
35040343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 10391114 - 10391155
Alignment:
| Q |
17 |
atgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10391114 |
atgacttttatgctcaaaaccgaaccaaaccacaccgcgaac |
10391155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 10590847 - 10590802
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcga |
56 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
10590847 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccgcga |
10590802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 58
Target Start/End: Original strand, 19135217 - 19135246
Alignment:
| Q |
29 |
ctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19135217 |
ctcaaaaccgaaccaaaccacaccgcgaac |
19135246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 40806904 - 40806947
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgc |
54 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
40806904 |
gtttggatgacttttatgctcaaaaccgaaccaaaccacaccgc |
40806947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 40900169 - 40900216
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
40900169 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccgcgaac |
40900216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 43630574 - 43630527
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
43630574 |
gtttggatgacttttatactcaaaatcgaaccaaaccgcaccgcgaac |
43630527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 41260265 - 41260228
Alignment:
| Q |
15 |
ggatgatttttattctcaaaaccgaaccaaaccacacc |
52 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41260265 |
ggatgatttttatgctcaaaaccgaaccaaaccgcacc |
41260228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 44979855 - 44979902
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
44979855 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccgcgaac |
44979902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 42785716 - 42785762
Alignment:
| Q |
12 |
tttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
42785716 |
tttggatgacttttatgctcaaaatcgaaccaaaccgcaccgcgaac |
42785762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 44035302 - 44035266
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaacc |
47 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
44035302 |
gtttggatgacttttatgctcaaaaccgaaccaaacc |
44035266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 16529586 - 16529633
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
16529586 |
gtttggatgacttttatgctcaaaaccgaaccaaaccgcaccgcgaac |
16529633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 27507581 - 27507624
Alignment:
| Q |
15 |
ggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27507581 |
ggatgacttttattctcaaaaccgaaccaaaccgcaccgcgaac |
27507624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 51252501 - 51252548
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
51252501 |
gtttggatgacttttatgctcaaaatcgaaccaaaccgcaccgcgaac |
51252548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 32954045 - 32953988
Alignment:
| Q |
1 |
tttatcttatgtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
||||||| | |||||||||| |||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
32954045 |
tttatctcaggtttggatgacttttatgttcaaaaccgaaccaaaccgcaccacgaac |
32953988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 69626 - 69673
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
69626 |
gtttggatgacttttatgctcaaaatcgaaccaaaccgcaccgcgaac |
69673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 40671 - 40718
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| | |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
40671 |
gtttggatgactattatgctcaaaaccgaaccaaaccgcaccgcgaac |
40718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 39097942 - 39097895
Alignment:
| Q |
11 |
gtttggatgatttttattctcaaaaccgaaccaaaccacaccgcgaac |
58 |
Q |
| |
|
|||||||||| |||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
39097942 |
gtttggatgacttttatgctcaaaatcgaaccaaaccaaaccgcgaac |
39097895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University