View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20925_low_16 (Length: 207)
Name: NF20925_low_16
Description: NF20925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20925_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 39302680 - 39302506
Alignment:
| Q |
15 |
ttattcttatgcatatgggaaggaggctaaggttggtgcttgaatccagatagaattattgagctgaatcatggttctgtttttcaacatatccaagttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39302680 |
ttattcttatgcatatgggaaggaggctaaggttggtgcttgaattcagatagaattattgagctgaatcatggttctgtttttcaacatatccaatttt |
39302581 |
T |
 |
| Q |
115 |
gttggaaggtccttccattagattagatattgtacaaatataaatgggtacgtatgtcttgaataaccatagagc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39302580 |
gttggaaggtccttccattagattagatattgtacaaatataaatgggtacgtatgtcttgaataaccatagagc |
39302506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University