View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_high_34 (Length: 250)
Name: NF20926_high_34
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 96 - 215
Target Start/End: Complemental strand, 9169742 - 9169627
Alignment:
| Q |
96 |
ttgtgagtgacatgttgaatgaatcactcttcaaacttgtataatttcnnnnnnnnnnnnctttgtaagccctcttagaggaggcagaagataatagaca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9169742 |
ttgtgagtgacatgttgaatgaatcactcttcaaacttgtataatttcatatatat----cttagtaagccctcttagaggaggcagaagataatagaca |
9169647 |
T |
 |
| Q |
196 |
tatactagtagtctagtaag |
215 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9169646 |
tatactagtagtctagtaag |
9169627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 9258594 - 9258649
Alignment:
| Q |
29 |
tacaattgagattcaagggacatccaatggatgcatcactcagaccaattccaagg |
84 |
Q |
| |
|
|||| ||||| || ||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
9258594 |
tacagttgagcttgaagggacatccaatggaagcatcacttagaccatttccaagg |
9258649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University