View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_high_35 (Length: 250)
Name: NF20926_high_35
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 234
Target Start/End: Original strand, 47266185 - 47266408
Alignment:
| Q |
11 |
cagagacgaggtaaagctatatatggttctaacttctaataccaatctagtgtgacacaagtattataggtttgggtgccttaataatttagtcggggat |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47266185 |
cagagatgaggtaaagctatatatggttctaacttctaataccgatctagtgtgacacaagtattataggtttgggtgccttaataatttagtcggggat |
47266284 |
T |
|
| Q |
111 |
tcaattccttgttagtgtgtatggaaaacatattttaggagagatcaactgctaaaaaggatcttaattatctcgagagattggtctcagcagttgtgta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47266285 |
tcaattccttgttagtgtgtatggaaaacatattttaggagagatcaactgctaaaaaggatcttaattatctcgagagattggtctcaacagttgtgta |
47266384 |
T |
|
| Q |
211 |
ctgtatggggatactttagtttac |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47266385 |
ctgtatggggatactttagtttac |
47266408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University