View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20926_high_36 (Length: 248)

Name: NF20926_high_36
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20926_high_36
NF20926_high_36
[»] chr3 (1 HSPs)
chr3 (15-229)||(24790824-24791038)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 24791038 - 24790824
Alignment:
15 cagagacgaagaacaagaacattatcacagtgatgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24791038 cagagacgaagaacaagaacattatcacagtgatgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattc 24790939  T
115 aacgaagacaaaatgatgggtatgaagattttgaaggtgaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcgtctatgaagagagctt 214  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |    
24790938 aacgaagacaaaatgatgggtatgaagattttgaaggttaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcttctatgaagagagcgt 24790839  T
215 atgtgaagttacaag 229  Q
    |||||||||||||||    
24790838 atgtgaagttacaag 24790824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University