View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_high_36 (Length: 248)
Name: NF20926_high_36
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 24791038 - 24790824
Alignment:
| Q |
15 |
cagagacgaagaacaagaacattatcacagtgatgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24791038 |
cagagacgaagaacaagaacattatcacagtgatgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattc |
24790939 |
T |
|
| Q |
115 |
aacgaagacaaaatgatgggtatgaagattttgaaggtgaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcgtctatgaagagagctt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
24790938 |
aacgaagacaaaatgatgggtatgaagattttgaaggttaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcttctatgaagagagcgt |
24790839 |
T |
|
| Q |
215 |
atgtgaagttacaag |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24790838 |
atgtgaagttacaag |
24790824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University