View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_high_37 (Length: 244)
Name: NF20926_high_37
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 136 - 229
Target Start/End: Complemental strand, 36684191 - 36684102
Alignment:
| Q |
136 |
accagatcaatgtttatgggagtgtttgatatataatggcttgaaggtacgtagggaatttcaacgaatcattgccacaaaaactacccaccaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36684191 |
accagatcaatgtttatgggagtgtttgaga----atggcttgaaggtacgtagggaatttcaatgaatcattgccacaaaaactacccaccaa |
36684102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 36 - 79
Target Start/End: Complemental strand, 36684241 - 36684198
Alignment:
| Q |
36 |
acctttaaagtcaaaacgtttataataaggtaactacaacaagt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36684241 |
acctttaaagtcaaaacgtttataataaggtaactacaacaagt |
36684198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University