View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_low_20 (Length: 379)
Name: NF20926_low_20
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 15632829 - 15632565
Alignment:
| Q |
1 |
atgtttctggaatctgtggcattacataaacccaaaccattaccatcataaattagtcaaatattggataaattactagggcaatacaaaccaagctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15632829 |
atgtttctggaatctgtggcattacataaacccaaaccattaccatcataaattagtcaaatattggataaattactagggcaatacaaaccaagcagca |
15632730 |
T |
 |
| Q |
101 |
tatactgatataccacagaca------ggatgcccgactccgaccaatctccctcccttgctctcatcgacgcataccctcaaataactccctctcatgc |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15632729 |
tatactgatataccacagacacagacaggatgcccgactccgaccaatctccctcccttgctctcatcgacgcatagcctcaaataactccctctcatgc |
15632630 |
T |
 |
| Q |
195 |
tctcctcgtcctcgacaccctcttaatcaagatcttcgatgtctacttctttactgaagcttgta |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15632629 |
tctcctcgtcctcgacaccctcttaatcaagatcttcgatgtctacttctttactggagcttgta |
15632565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University