View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_low_25 (Length: 307)
Name: NF20926_low_25
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 44695105 - 44695383
Alignment:
| Q |
18 |
agaagaaaccaatgggaaagatgccggagaaagaaaagaggaaaagaatggtgaattgaagacaagtgcatctaatgcttgtgagattgcagtggttgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695105 |
agaagaaaccaatgggaaagatgccggagaaagaaaagtggaaaagaatggtgaattgaagacaagtgcatctaatgcttgtgagattgcagtggttgaa |
44695204 |
T |
 |
| Q |
118 |
ggttcagttgaaggaagcaacgggagcgttgatactctgaacatgatggacactgatgttggctgtttgatagcaactaccaattcaatgacagcagttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44695205 |
ggttcagttgaaggaagcaacgggagcgttgatactgtgaacatgatggacactgatgttggctgtttgatggcaactaccaattcaatgacagcagttg |
44695304 |
T |
 |
| Q |
218 |
ttgccgcaaatgaggaagtaaaacaatcttttgaagatgatttaaactcaacaagttcttcaccctgtgaatggttcat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695305 |
ttgccgcaaatgaggaagtaaaacaatcttttgcagatgatttaaactcaacaagttcttcaccctgtgaatggttcat |
44695383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 183 - 298
Target Start/End: Complemental strand, 39146597 - 39146482
Alignment:
| Q |
183 |
tttgatagcaactaccaattcaatgacagcagttgttgccgcaaatgaggaagtaaaacaatcttttgaagatgatttaaactcaacaagttcttcaccc |
282 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||| ||||| ||||| |||||||||||||| || ||| ||||||| |||||||||| ||| ||||| |
|
|
| T |
39146597 |
tttgatggcgactactgattcagtgacagcagtggttgcggcaaaggaggaagtaaaacaggctgttgcagatgatctaaactcaactcattcatcacct |
39146498 |
T |
 |
| Q |
283 |
tgtgaatggttcatct |
298 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39146497 |
tgtgaatggttcatct |
39146482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University