View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_low_29 (Length: 294)
Name: NF20926_low_29
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 38 - 294
Target Start/End: Original strand, 9169349 - 9169605
Alignment:
| Q |
38 |
tattagaaagagagtgttcctaacactttcttcgagccatacttatataccggattattattcataaagcaacacgtatctaaggacaaaatttatttct |
137 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9169349 |
tattaaaaaaagagtgttcctaacactttcttcgagccatacatatataccggattattattcgtaaagcaacacgtatctaaggacaaaatttatttct |
9169448 |
T |
 |
| Q |
138 |
tgccgtccacagataatgagaagtcttttagccttcgttcttgaatttcacctgtataagttaattattaaggacaaaattgtagttgttgacttgttat |
237 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9169449 |
tgccgtccacggataatgagaaatcttttagccttcgttcttgaatttcacctgtataagttaattattaaggacaaaattgtagttgttgacttgttat |
9169548 |
T |
 |
| Q |
238 |
atgtgaaaattttgtcgtgatggtcttggacttggatgattcttaatctatacttat |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9169549 |
atgtgaaaattttgtagtgatggtcttggacttggatgatttttaatctatacttat |
9169605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University