View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20926_low_38 (Length: 244)

Name: NF20926_low_38
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20926_low_38
NF20926_low_38
[»] chr1 (2 HSPs)
chr1 (136-229)||(36684102-36684191)
chr1 (36-79)||(36684198-36684241)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 136 - 229
Target Start/End: Complemental strand, 36684191 - 36684102
Alignment:
136 accagatcaatgtttatgggagtgtttgatatataatggcttgaaggtacgtagggaatttcaacgaatcattgccacaaaaactacccaccaa 229  Q
    ||||||||||||||||||||||||||||| |    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
36684191 accagatcaatgtttatgggagtgtttgaga----atggcttgaaggtacgtagggaatttcaatgaatcattgccacaaaaactacccaccaa 36684102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 36 - 79
Target Start/End: Complemental strand, 36684241 - 36684198
Alignment:
36 acctttaaagtcaaaacgtttataataaggtaactacaacaagt 79  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
36684241 acctttaaagtcaaaacgtttataataaggtaactacaacaagt 36684198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University