View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_low_41 (Length: 238)
Name: NF20926_low_41
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 43513779 - 43513558
Alignment:
| Q |
1 |
cccttatttgatttctctttcgtattacttctgttgatttattcgtatgattgctctatcttttgcagagttgatggtgaagctagttgaattatgtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513779 |
cccttatttgatttctctttcgtattacttctgttgatttattcgtatgattgctctatcttttgcagagttgatggtgaagctagttgaattatgtggt |
43513680 |
T |
|
| Q |
101 |
tcatcagtcacactgaaatgtccattaccaaacggagatttagagacattgatttcaatcaccagcgatgaagatctgaaaaatataattgaagaatacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513679 |
tcatcagtcacactgaaatgtccattaccaaacggagatttagagacattgatttcaatcaccagcgatgaagatctgaaaaatataattgaagaatacg |
43513580 |
T |
|
| Q |
201 |
atcgcgcttcttcatcattaat |
222 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
43513579 |
atcgagcttcttcatcattaat |
43513558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 175
Target Start/End: Complemental strand, 34589665 - 34589551
Alignment:
| Q |
61 |
ttttgcagagttgatggtgaagctagttgaattatgtggttcatcagtcacactgaaatgtccattaccaaacggagatttagagacattgatttcaatc |
160 |
Q |
| |
|
||||||||| |||||||||||||| | ||||| || |||||||| || || | |||| ||||||||||||||||||||| || |||||||| ||| |
|
|
| T |
34589665 |
ttttgcagaattgatggtgaagcttgaagaattgtgcggttcatctgtgactttacggtgtcaattaccaaacggagatttagaaacgttgatttccatc |
34589566 |
T |
|
| Q |
161 |
accagcgatgaagat |
175 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
34589565 |
accaacgatgaagat |
34589551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University