View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_low_42 (Length: 238)
Name: NF20926_low_42
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 47266526 - 47266749
Alignment:
| Q |
1 |
tagataatgatctggccagtcccactgttaagacttttttaaggcaagagattgccaaatctgtttattaattattttgtttttgaaaatgtcaattatg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47266526 |
tagataatgatctgggcagtcccactgttaagacttttttaaggcaagagattgccaaatctgtttattaattattttgtttttgaaaatgtcaattatg |
47266625 |
T |
|
| Q |
101 |
ttaagaaaattgaaaagacaatagactaattattgtagtttctgtgatacaggaggtttaatgaaattgtctgtaagaagaaaaacgtgagtttggtttt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47266626 |
ttaagaaaatcgaaaagacaatagactaattattgtagtttctgtgatacaggaggtttaatgaaattgtctgtaagaagaaaaacgtgagtttagtttt |
47266725 |
T |
|
| Q |
201 |
ttagttgtttatctatgttttgga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47266726 |
ttagttgtttatctatgttttgga |
47266749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 100
Target Start/End: Original strand, 47258967 - 47259043
Alignment:
| Q |
24 |
actgttaagacttttttaaggcaagagattgccaaatctgtttattaattattttgtttttgaaaatgtcaattatg |
100 |
Q |
| |
|
||||||| ||||||| |||||||||| | |||||||||||||| ||| ||||| |||||||| |||||||| ||||| |
|
|
| T |
47258967 |
actgttatgacttttctaaggcaagaaagtgccaaatctgtttgttagttattctgtttttggaaatgtcatttatg |
47259043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University