View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20926_low_46 (Length: 225)
Name: NF20926_low_46
Description: NF20926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20926_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 15833008 - 15832818
Alignment:
| Q |
19 |
ttatttaaacgcgaaaaactcaaagatgcgcgaaaacaaaggacccttatgtctttatgttttacgtcgcgaatagaaagaacttgggtgatgaaatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15833008 |
ttatttaaacgcgaaaaactcaaagatgcgcgaaaacaaaggacccttatatctttatgttttacatcgcgaatagaaagaacttgggtgatgaaatcaa |
15832909 |
T |
|
| Q |
119 |
gttttgaagaagataaagggtgtcttgatatatcaattttcttatgatttttggttgaaataagtggaaatggatcaagagttgtgaaatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15832908 |
gttttgaagaagataaagggtgtcttgatatatcaattttcttatgatttttggttgaaataagtggaaatggatcaagagttgtgaaatc |
15832818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University