View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20928_high_10 (Length: 235)
Name: NF20928_high_10
Description: NF20928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20928_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 5776309 - 5776519
Alignment:
| Q |
11 |
caaaggctatgatagtgaaagatacaaagtctgaaccaaacttgattgtggttgcatttagaggtacaactccatttgacgctgtgcaatggaaaacaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5776309 |
caaaggctatgatagtgaaagatacaaagtctgaaccaaacttgattgtggttgcatttagaggtacaactccatttgacgctgtgcaatggaaaacaga |
5776408 |
T |
|
| Q |
111 |
cgttgatatctcctggtatgacctaccaaacgtgggaaagatgcatggtggattcatgaaagctttgggactattagagaacggtggatggcccaaagaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5776409 |
cgttgatatctcctggtatgacctaccaaacgtgggaaagatgcatggtggattcatgaaagctttgggactattagagaacggtggatggcccaaagaa |
5776508 |
T |
|
| Q |
211 |
attgatgaaag |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
5776509 |
attgatgaaag |
5776519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University