View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20928_high_8 (Length: 257)
Name: NF20928_high_8
Description: NF20928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20928_high_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 24 - 257
Target Start/End: Complemental strand, 8988267 - 8988034
Alignment:
| Q |
24 |
atgaggcaatagcttgcccatatattttcctctttgcctgcatgatgtataacctcctcatgcatgatgcgtaacttacatgagttggttaattgatttt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8988267 |
atgaggcaatagcttgcccatatattttcctctttgcttgcatgatgtataacctcctcatgcatgatgcgtaacttacatgagttggtttattgatttt |
8988168 |
T |
|
| Q |
124 |
cttcattccttgtcccatttatctttcacaataatgtatgtagtggctatatccctatagatcccttaatacatattgtaaaaagtataccatgaacatg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8988167 |
cttcattccttgtcccatttatctttcacaataatgtatgtagtggctatatccctatagatcccttaatacatattgtaaaaagtataccatgaccatg |
8988068 |
T |
|
| Q |
224 |
aaattgtcttgttagggtgaattcgatctgattc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8988067 |
aaattgtcttgttagggtgaattcgatctgattc |
8988034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University