View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20929_high_12 (Length: 256)
Name: NF20929_high_12
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20929_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 32288510 - 32288280
Alignment:
| Q |
10 |
agcagcacagacagactaactaagcaccattgccagcaccaagnnnnnnnnnn---ctaagcactaaaaatactatagctagctatgacccatgacctta |
106 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32288510 |
agcaacacacacagactaactaagcaccattgccagcaccaagaaaagaaaaaaaactaagcactaataatactatagctagctatgacccatgacctta |
32288411 |
T |
|
| Q |
107 |
tatatcaatgcacgcagcttcttcatttctgcttattgccacccatgttcatgttcattccagcattgccacctgcagcaccaccgccgccgccgcccat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32288410 |
tatatcaatgcacgcagcttcttcatttctgcttattgccacccatgttcatgttcattccagtattgccacctgcagcaccaccgccgccgccacccat |
32288311 |
T |
|
| Q |
207 |
atttgcttcttgtccaccctgtcctccacca |
237 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
32288310 |
atttgcttcttgtccactctgtcctccacca |
32288280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University