View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20929_high_16 (Length: 249)
Name: NF20929_high_16
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20929_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 35212816 - 35213042
Alignment:
| Q |
18 |
cttgggtcataagcaggaaaagtttttcctattcaccaataataaattgtcacaactacactccactatgtataacattagaggtattagtatactatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35212816 |
cttgggtcataagcaggaaaagtttttcctattcaccaataataaattgtcacaactacactccactatgcataacattagaggtattagtatactatta |
35212915 |
T |
 |
| Q |
118 |
aatcacatgaacctgatgcagcatccacaaatttcccattaatgagattctttgtgtatcttatttccacagatggtgtgattaattcatcaacttcagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212916 |
aatcacatgaacctgatgcagcatccataaatttcccattaatgagattctttgtgtatcttatttccacagatggtgtgattaattcatcaacttcagc |
35213015 |
T |
 |
| Q |
218 |
agcagtgctcaacttgcctatgcttct |
244 |
Q |
| |
|
||||||||||||||||| |||| |||| |
|
|
| T |
35213016 |
agcagtgctcaacttgcttatgtttct |
35213042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University