View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20929_high_21 (Length: 242)
Name: NF20929_high_21
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20929_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 26203385 - 26203165
Alignment:
| Q |
3 |
gtttgtaaagaaacggtttccgttgacgaggaagcgaaacagcttccttgtgatcatctttatcatgcggattgtattactccgtggcttcggattcgtt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203385 |
gtttgtaaagaaacggtttccgttgacgaggaagcgaaacagcttccttgtgatcatctttatcatgcggattgtattactccgtggcttcggattcgtt |
26203286 |
T |
|
| Q |
103 |
cttcttgtcctctttgtcggtgtggaattgtggaggatgaagaggatgagaatgatgaggaagatgatcttaatggtggagatgtgatgcgggagatggt |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26203285 |
cttcttgtcctctttgtcggtgcggaattgtggaggatgaagaggatgaggatgatgaggaagatgatattaatggtggagatgtgatgcgggagatggt |
26203186 |
T |
|
| Q |
203 |
gatgcggttgtcggagttgtc |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26203185 |
gatgcggttgtcggagttgtc |
26203165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University